Molecular Genetics
Sequence Complexity
Facts | Interpretations | Further Info. | Other Pages
The relative information content of DNA can be described by its sequence complexity, a quantity obtained from DNA reassociation kinetics.
|
bacterium
|
animal
|
genome size
|
0.004 pg
|
3 pg
|
genomes/12 pg
|
3000
|
4
|
specific seq. con.
|
750 x
|
x
|
k (rate constant)
|
750 y
|
y
|
|
|
z
|
750 z
|
Facts
- Chemical complexity is the amount of DNA in a haploid cell, nucleus or organelle. The chemical complexity of a unit's DNA is also called its genome size.
- There are more different sequences in 3 pg animal nuclear DNA than in 0.004 pg of bacterial DNA. Conversely, in 12 pg of DNA there are many more copies of a genome if the genome is bacterial than if the genome is vertebrate. The animal DNA is more complex.
- Kinetic complexity is defined as the amount of DNA (in base pairs) required so that every sequence of a DNA is represented just once.
- For the calculation of complexity, E. coli DNA is used as a standard because it is readily available.
Cot 1/2 of X
------------------ x 4.2 x 106 bp = complexity of X
Cot1/2 of E.coli
- Repetition frequency, f, is defined as:
f = (chemical complexity/ kinetic complexity )
| Nucleic Acid |
Kinetic Complexity |
| AAAAAAAAA |
1 bp |
| ATCGAATCGAATCGAATCGA |
5 bp |
| FX 174 RF DNA |
5836 bp |
| CaMV DNA |
8000 bp |
| bacteriophage T4 |
1.7 x 105 bp |
| E. coli |
4.2 x 106 bp |
Facts | Interpretations | Further Info. | Other Pages
Interpretations
- Genomes vary widely in size. Thus , the amount of DNA per cell or haploid nucleus also varies widely.
- Larger genomes reassociate at higher Cot1/2 values than do smaller ones
Facts | Interpretations | Further Info. | Other Pages
Further information
- Cot 1/2 values used for complexity calculations are obtained from the rate constant, correcting for the contribution of that component to the total genome. For example, consider a component that is 45% of total and has an apparent Cot 1/2 of 630. If it constituted 100% of the DNA, it would be 100/45 fold more concentrated. Thus, 0.45 x 630 = 283 (Cot 1/2 corrected).
- For many organisms, the repetition frequency calculated for the kinetically identified unique DNA class is close to 1.0, indicating that these DNAs are truly unique in the genome.
Last | Vocabulary | Overview | Top | Next
This is page 112283 of Molecular Genetics by Ulrich Melcher, © 1997-2000
E-mail inquiries to U. Melcher------------Last Updated: 18 September, 2000