Molecular Genetics
Other Pages
Molecular Maps
Several kinds of maps are useful in understanding the molecular chromosome.
AAGATCCCGATCCGATTAGCTTAG
- Restriction maps locate the relative positions of cleavage by selected restriction
enzymes.
- Contig maps locate the relative positions of cloned sequences from a library.
- Nucleotide sequences represent the ultimate molecular map, being the linear order
of nucleotides in the nucleic acid.
Last | Overview | Top | Next
This is page 1123 of Molecular Genetics by Ulrich Melcher, ©1997, 1998
E-mail inquiries to U. Melcher------------Last Updated: 10 September, 1998